10/13/2014
Finish Virtual Screening Refresher
Start Run 2: 1pm
10232014- Include more details and images
Week 7
10/10/2014
Began work on Virtual Screening Refresher
Start of Run: 12:21pm
Will assess if clones match up with BpACR: All clones came out with "no significant matches found" or a little matching as shown below:
Figure 1: Above is an example of the BLAST between the BpACR sequence and the DNA sequencing results that I received.
The sequences that matched were just part of the pNic backbone.
A BLAST with any known sequences shows below: Figure 2: Above is the result of blasting the last (3F) sequence from DNA sequencing with any known sequences.
The first match is with the pNic vector.
Week 6
--No lab work--
Week 5
9/22/2014
DNA Sequencing results arrived: Order ID:
Label:
1F- Plate C Colony 1
1R- Plate C Colony 1
2F- Plate D Colony 1
2R- Plate D Colony 1
3F- Plate D Colony 2
3R- Plate D Colony 2
Week 4
9/19/2014
Miniprep of overnight cultures
Resulted in good concentrations in each of the 3 tubes.
Nanodrops:
Figure 1: Tube 1 culture from the Colony on Plate C came out with a concentration of about 49.5 ng/ul at 230 nm wavelngth and 10 mm Absorbance pathway.
Figure 2: Tube 2 culture from the first colony on Plate D had a concentration about 43.5 ng/ul at 230 nm wavelength and 10 mm Absorbance pathway.
Figure 3: Tube 3 culture from second colony in Plate D had a concentration of about 56 ng/ul at 230 nm wavelength and 10 mm Absorbance pathway.
9/18/2014 Master Plate & overnight culture
Tube 1: Colony 1 from Plate C
Tube 2: Colony 1 from Plate D
Tube 3: Colony 2 from Plate D
Set overnight culture in LB+ Kan tubes in incubator (max ~16 hours), made Master Plate (LB, Kan, Suc) with all 3 of those colonies (7pm)
Checked Plates and there were colonies!
Figure 1: Plates A and B didn't have any growth. The dots are sucrose crystalized due to the incubation.
Figure 2: Plates C and D both had growth. Plate C had 1 colony, Plate D had 2. Again, there are many sucrose crystals.
Cohesion End Generation
Same protocol as usual, make sure sterile!
-instead of using 30 minutes at RT, I changed to 50 minutes.
-heat shock time interval remained the same
9/15/2014 pNic Accepting Vector Prep
two samples made as usual.
Concentration: 110.5 ng/ul
Figure 1: Nanodrop results of accepting vector prep. Concentration was 110.5 ng/ul at 230nm wavelength on a 10 mm pathway.
Week 3
9/10/2014
Repeat PCR squared and PCR Cleanup
Made twice as much Tube A and Tube B
Nanodrop:
Figure 1: Nanodrop of Tube A of PCR squared sample. Concentration was about 75 ng/ul at 230 nm wavelength on 10 mm absorbance pathway.
Figure 2: Nanodrop of Tube B of PCR squared sample. Concentration was about 100 ng/ul at 230 nm wavelength on 10 mm absorbance pathway.
9/9/2014
Repeat pNic AV Prep (couldn't use because didn't have any PCR squared sample)
9/8/2014
Make LB agar plates- 23 plates made
Week 2
9/7/2014
Plate Check:
Figure 1: Plates A-D all had heavy contamination.
Unsure as to why, but potentially the Kanamycin used on the plates had gone bad.
Cohesion End Generation
PCR Insert (make 3 tubes) and Accepting Vector
9/3/2014 pNice Accepting Vector
Same protocol
Nanodrop:
Figure 1: Nanodrop of AV Prep of pNic-Bsa4. Concentration is about 85 ng/ul at 230 nm wavelngth on 10 mm Absorbance.
Samples were good concentration so they should be good to use with cohesion end generation.
Agarose Gel:
Figure 1: Agarose gel of cut pNic. The second ladder is 1 kb ladder and the sample to the right of it is my cut pNic.
The SacB gene that was removed is slightly visible in this agarose gel. The RE digest was successful.
Week 1
8/29/2014 PCR squared
Concentration:
Figure1: Nanodrop of PCR square. Concentration is about 42 ng/ul at 230 nm wavelength on 10 mm Absorbance.
Agarose gel of Secondary PCR
Figure 1: Agarose gel of secondary PCR. Lane 1 is the 1000 bp ladder, Lane 2 is the 1 kb ladder,
and Lane 3 is my secondary sample.
My secondary sample is under the 1 kb marker and above the 500 bp marker, and is approximately 750 bp. This is really close to BpACR's 747 bp length.
PCR Squared:
Same protocol as before but made twice as much. Start @ 2:55pm to 3:45
Secondary PCR:
Same protocol
8/28/2014
Left PCR squared sample in Lamborghini and someone turned it off overnight, so sample was lost. PCR squared
same protocol as usual
Secondary PCR
Same protocol as usual
-----------------------------END OF SUMMER 2014--------------------------------
Week 9
7/30/2014
Resulting Plates from Run 4 of Cohesion End Generation and Annealing
Figure1: Plate A (2:4)
Figure 2: Plate B (4:4)
Figure 3: Plate C (3:5)
The plates didn't have growth when I checked at 1pm, but I checked again at 4:30pm and plate B had a little bit of growth.
I won't be able to come into lab for the remainder of summer, so since I couldn't store these plates until Fall, I had to throw away the plates :'( (Sad day)
7/29/2014 Cohesion End generation and Plating
Follow same protocol but different ratios this time
Plate
AV uL
PI uL
A
2
4
B
4
4
C
3
5
Results will be assessed tomorrow.
Other procedures:
Tried making plates but Autoclaving the LB caused it to overflow twice
Great images shown below! :D
Round 1: Autoclave v. VDS => Autoclave
Round 2: Autoclave v. VDS => Autoclave
Action shots!
Boss Level: Cidia/Zain v. solidified LB ==> CIDIA/ZAIN
Covering up the losses :(
Lesson Learned: Use Liquid 6 now!
Next time VDS will win!
7/28/2014 Rerun of pNIC-Bsa4 Accepting Vector Prep
Redo same protocol, but made sure to use Buffer 4! I had potentially been using Buffer 2 for this step.
Figure 1: Nanodrop of pNIC AV prep with BsaI. 10 mm pathway, 230 nm wavelength. 88.2 ng/ul
Figure 2: Nanodrop of pNIC AV Prep with BsaI. 10 mm pathway, 230 nm wavelength. 89.2 ng/ul
The concentration was good at 88.7 ng/ul so tomorrow I will continue the Cohesion end generation.
Week 8
7/24/2014 Rerun of DNA sequencing results:
The forward primer results had many Ns, so I used the reverse, and looking at the graph matched up the Ns with the correct base pair.
They all matched, so this is a successful pNIC-Bsa4 and can be used as the vector.
Rerun of Cohesion End Generation and Annealing/Tranformation Plates
Repeat the same procedure as last time, but this time allow plates to grow without parafilm or seran wrap.
Same ratios were used.
Figure 1: Plates A-F of run 3 DH5alpha with pNIC-Bsa4 and BpACR.
There was still no growth. Time to rerun...
7/23/2014 DNA Sequencing results
There are many Ns within the two sequences, but the Core emailed saying they will dilute and rerun.
Results of second run of cloning plates
Figure 1: I didn't get a chance to take pictures of individual plates.
There was no growth yet again.
Rerun of PCR squared to make more of BpACR insert
Figure 1: Nanodrop (2 trials) of BpACR insert after PCR squared was ran. 10 mm pathway. 230 nm wavelength. Concentration came to be 112 ng/ul.
Rerun of pNIC-Bsa4 Prep as Accepting Vector
Same protocol and steps as before.
Figure1: 12 images of the 6 tubes of pNIC Accepting vector that was prepared with BsaI. 10 mm Pathway. 230 nm wavelength. The concentration came out to be 25.2 ng/ul.
The concentrations all came out low due to using 50 uL of elution solution
7/22/2014 Redo Cohesion End Generation
and plating
Same protocol and but I made twice the amount of PCR Insert to allow for the 6 plates that I planned to make this round.
The ratios I used were as follows:
Plate
Accepting Vector uL
PCR Insert uL
A
2
4
B
2
3
C
2
5
D
3
4
E
3
5
F
3
3
In SOC media and then plated after the 1 hour incubation.
Figure 1: I didn't get a chance to take pictures of individual plates, but there was no growth.
I also ran a gel on the cut pNIC-Bsa4 with BsaI, to ensure that the accepting vector was cut correctly.
Figure 1: Agarose gel of pNIC-Bsa4 cut with BsaI. Lane 1 is the 1kb ladder. Lane 2 is the sample of cut pNIC.
The plasmid was cut at the correct length it seemed.
Other Procedures:
Made plates: first forgot to put in Agar, so had to remake plates. Made ~60 plates total
7/21/2014 DNA Sequencing of pNIC
Sent samples to be sequenced
Rerun of Vector prep (Run 4)
I reran the Vector prep protocol, the concentration came out good this time.
Figure 1: Nanodrop of pNIC Accepting vector prep at 10 mm pathway, 230 nm wavelength.
Concentration is 69.7 ng/ul (n=2).
Figure 2: Nanodrop of pNIC Accepting vector prep at 10 mm pathway, 230 nm wavelength.
Concentration is 71.2 ng/ul (n=2).
my partner is the best aka Nikki shes so cool can i be her i wish hahaah
Zain - ok good work. Go into another round of cloning and see if you can get colonies. Go ahead and think about getting a 3rd round going shortly after you have the second one started. - Dr. B 072114
Week 7
Good work. Is this sequential? Try to put dates on specific protocol and results. Keep the newest stuff on the top. -Grace (7/15/14) 7/18/2014
MidiPrep of pNIC plasmid
the culture of bacteria grown overnight was midiprepped
Post midiprep, the concentration was taken:
Figure 1: Nanodrop of pNIC midiprepped sample (n=2). Concentration is 77.7 ng/ul at 230 mm Absorbance at 10 mm pathway.
Figure 2: Nanodrop of pNIC midiprepped sample (n=2). Concentration is 79.8 ng/ul at 230 mm Absorbance at 10 mm pathway.
I also need to send to DNA sequencing.
pNIC accepting vector re run Concentrations
concentration came out too low so I will redo next week.
Figure 1: Nanodrop of pNIC accepting vector prep at 10 mm Absorbance. Concentration of 5.3 ng/ul at 230 nm wavelength. (n=2)
Figure 2: Nanodrop of pNIC accepting vector prep at 10 mm Absorbance. Concentration of 6.8 ng/ul at 230 nm wavelength. (n=2)
The concentration is very low, so I will rerun this step next week.
7/17/2014
Plates didn't have growth at 1pm, 3pm, or 6:30pm. Check again tomorrow, if no growth, remake pNIC-Bsa4 accepting vector and repeat.
Figure 1: Plates A-D with DH5-alpha cells containing pNIC-Bsa4 and BpACR insert on LB Amp plates.
There was no growth on these plates, I will rerun the protocol.
The plates had no growth because they were ampicillin plates, so the bacteria potentially died if there was going to be any growth.
ugh :( stupid mistakes!
Grow pNIC-Bsa4 plasmid in DH5-alpha cells in overnight flask culture
Prepare sucrose 20% solution for LB agar + Kan plates.
Added 40g of sucrose to 200mL water. Bottle Top filtered and added 167 mL of that to 500mL LB agar solution.
Rerun of Accepting vector prep
same as before and run PCR Cleanup, nanodrops are on next day.
Cohesive End Generation on PCR Insert and Accepting Vector: (7/16/18)
Mixed components together: fragment/vector, NEBuffer 2, dCTP/dGTP, DTT, BSA, and T4 DNA Pol.
Incubate first at room temperature for 30 minutes, and then for 20 minutes heat shock at 75C.
Here someone may have accidentally bumped up my 75C heat block to 110C, and this denatured my sample.
So i had to redo it, then moved onto the Annealing and Transformation.
Annealing and Transformation:
For plate A i did 2 uL of Accepting vector to 4 uL of PCR Insert
Plate B- 3 uL of Accepting vector to 4 uL of PCR Insert
Plate C- 2 uL of Accepting vector to 5 uL of PCR Insert
Plate D- 3 uL of Accepting vector to 3 uL of PCR Insert
Incubate at room temp for 10 minutes, then place on ice and add 25 uL of DH5-alpha cells. Incubate for 30 minutes on ice, then heat shock at 42C.
Place on ice and add pre warmed SOC media.
Incubate each of these samples in the 37C shaker for 1 hour.
After the 1 hour, spread these onto LB-agar plates with Kanamycin.
Parafilm the 4 plates after labeling. Incubate for 1 day in 37C (start time: 9pm 7/16/14)
Began Transfer of Gene of interest into pNIC-Bsa4 (7/14/14)
Add the plasmid, buffer, BSA, Restriction Enzyme BsaI-HF into 2 tubes.
Incubate for 3 hours after making the 2 tubes of sample to prepare pNIC-Bsa4 for BpACR.
Figure1: Water bath set to 37C, to incubate the samples for 3 hours.
PCR cleanup this sample to extract the pNIC-Bsa4 cut plasmid.
Nanodrop this sample.
I then ran a gel on the prepared pNIC Bsa4 vector, to ensure that the BsaI restriction enzyme worked and resulted in 2 pieces.
I had to repeat the pNIC-Bsa4 preparation because my concentration of 26 ng/uL was low.
7/15/18
Here are the Nanodrop results from that:
(Place Nanodrops of sample here)
I then ran a gel again on the prepared pNIC Bsa4 vector, to ensure that the BsaI restriction enzyme worked and resulted in 2 pieces.
Week 6
Trip to TACC site at Pickle Campus:
(Insert Pictures here)
Oligomix and PCR to obtain full Sequence:
Look up where my oligos are located:
My samples of BpACR were located in B12, C1-12, D1-5 (18 wells total).
100-18= 82 uL of water into a 1.7ml PCR tube.
Pipette up and down in each well then add 1 uL from each well into the PCR Oligomix tube, to make total of 100 uL.
Pipette up and down to mix Oligomix.
Run Primary PCR:
Sample: 10uL of 5X Rxn Buffer, 5 uL of diluted 2mM dNTPs, 1 uL of Oligomix, 0.5 uL of diluted Q5 hotstart Polymerase (1U/ul), 33.5 uL of dH2O
Run Agarose Gel:
Mix 10 ul of this sample and 2 ul of blue juice and put into wells.
Results:
Secondary PCR: (7/9/2014)
Sample: 10uL of 5X Rxn Buffer, 5 uL of diluted 2mM dNTPs, 1 uL of Oligomix, 1uL of 20 uM F primer, 1uL of 20 uM R primer, 0.5 uL of diluted Q5 hotstart Polymerase (1U/ul), 31.5 uL of dH2O
Stored in my Box @ -20C, run Gel tomorrow Gel Results:
Figure1: Lane 2 is the 1kb ladder, Lane3 is my primary PCR sample, Lane4 is my secondary PCR sample. Lane 6-7 are Brianna's samples.
Secondary PCR results from the gel show that the primers forward and reverse worked in connecting the oligos into a single strand pretty efficiently.
PCR Cleanup:
I ran PCR cleanup, following instructions to adding the solutions. But instead of using the table top centrifuge, I used the bubble centrifuge, so the sample was centrifuged at 6000g instead of the 12000-16000g requested. :(
I then added an extra 20 uL of Elution buffer and ran the sample in the filter/collection tube unit for 2 minutes at 16000g.
Figure1: I resulted in getting a sample that was 70 ng/uL from Nanodrop using a 10 mm Absorbance pathway.
Figure 2: 701 ng/uL from Nanodrop using a 10 mm Absorbance pathway at 230 nm wavelength.
The overall concentration is 71.55 ng/uL.
This means that even though I didn't use the correct centrifuge, I still have DNA in my sample. I will send for DNA sequencing on Monday. The potentially redo PCR squared if the sequence is incorrect.
Run PAGE Gel from Characterization:
Fill with 1X TGS Buffer, over fill space between gel and buffer dam and fill until 2 gels line.
Remove comb and Clear wells with syringe.
Prepare samples 3-6 (since we didn't have 0-2). Add 4uL of blue juice to 20uL of sampel to reduce 6X-->1X.
Then heat block at 95C for 5min. Centrifuge for 2 min at 5000 rpm.
Fill wells with Colorstain protein ladder and samples 3-6 and run for 45 minutes, on 200V.
Destaining Gel:
Wash in water 3 times, and wash overnight to remove staining.
Destaining in progress
Remove from water and take a picture before drying.
Put on filter paper and cover with cellophane as seen below.
Resulting Dried Gel:
PAGE Gel: first lane is the Colorstain Ladder, then Samples 3-6. Since Sample 6 shows a darker sample. It is upside down when we placed it on the filter paper before drying, so the results are Right to Left instead of Left to Right. The top gel fell off when we were transferring the gel onto the filter paper.
Next time run PAGE gel for longer than 20 minutes, this way the lines are more spaced out.
This means our protein was amplified and we should FPLC the remaining sample to extract the FtHap protein
Restriction Enzyme Digest:
Goal: digest pGBR22 plasmid with restriction enzymes and visualize fragments on gel.
EcoRI and PvuII both use NEB Buffer 2.1, or 2.
1: EcoRI
2: PvuII
3: EcoRI and PvuII
Digestion:
1.5 ug plasmid (304.2 ng/ul --> 4.93 ul)
2.5 ul 10X Enzyme Buffer
X uL water to 24 uL total
1 uL of Restriction enzyme (or 0.5 of each)
Total: 25 uL.
Pipette up/down to mix. Spin down, wrap with Parafilm and incubate for 2 hours in 37C.
Kill enzyme at 85C for 20 minutes, then spin down.
Prepare the samples for Gel electrophoresis, but adding 3 uL of plasmid, 2 uL of blue juice, and 7 uL of buffer.
Run gel:
BLAST pNIC sample from MidiPrep. Sequence turned out to be not as close to pNIC sequence as desired, so trash sample of pNIC.
Week 5
pGBR22 Rerun: Agarose gel for pNIC (Nikki) and pGBR22 (Zain) PCR gel. Lane 1 has the 1kb DNA ladder, Lane 2-5 are pNic, Lanes 6-9 are pGBR22. pGBR22 should show an increasing light gradient upon increase of pGBR22 template, but there may have been a mixup of tubes causing the altered view.
pLIC PCR (Second PCR Protocol):
Made 3 dilutions of pNIC: 1:10 (7.625ng) , 1:100 (0.7625ng), and 1:1000 (.07625ng) (add 1 uL per tube)
Master mix: 12.5 Buffer, 2.5 dNTP, 5 of F and R primers, 90 DDW; add 23 uL in each tube
add 18 uL of water into each tube, but 19 uL in control tube.
DNA sequence with Leading and Lagging strands of primer: Primer Selection: TACTTCCAATCCATGCAGGCTAAGCGCGTTGCGTTTGTTACGGGTGGCATGGGTGGTCTGGGTGCTGCGATCTCTCGTCGTCTG CACGACGCCGGTATGGCTGTTGCAGTTTCTCACTCTGAACGTAACGATCATGTTTCTACCTGGCTGATGCACGAACGTGATGCG GGTCGTGACTTCAAAGCTTACGCTGTTGACGTCGCGGATTTCGAATCTTGCGAACGTTGCGCGGAAAAAGTTCTGGCGGACTTC GGTAAAGTGGATGTTCTGATCAACAACGCAGGCATTACCCGTGACGCGACCTTTATGAAAATGACCAAAGGTGACTGGGACGCG GTTATGCGTACCGACCTGGACGCGATGTTCAACGTTACCAAACAATTCATCGCGGGTATGGTTGAACGTCGTTTCGGTCGTATTG TTAATATCGGTTCTGTTAATGGTTCTCGTGGTGCGTTCGGTCAAGCGAACTACGCGTCTGCGAAAGCGGGCATCCACGGTTTCAC CAAAACCCTGGCGCTGGAAACCGCGAAACGTGGTATCACCGTTAACACCGTTTCTCCGGGTTACCTCGCTACTGCCATGGTCGAA GCGGTTCCGCAGGACGTTCTGGAAGCGAAAATCCTGCCGCAGATCCCGGTTGGTCGCCTGGGTCGTCCGGATGAAGTTGCGGCG CTGATCGCGTTCCTGTGCTCTGACGACGCGGGCTTTGTAACCGGTGCGGACCTGGCGATCAACGGTGGTATGCACATGTCTTAA
Protein Expression:
FtHap in BL21 cells.
Small Culture 6/30/14
Large Culture: added total of 25 mL when OD600=0.104 (7/1/14)
After adding Kan, and incubating (37C), check every 30 minutes until OD600=0.5. But went over to 0.684, because we were in FPLC room observing.
So more sample.
added 259.5 uL of IPTG to induce expression. Incubate for 4 hours.
Centrifuge (20 min, 6000g, 4C, in 500ml cyndrical bottles) and collect pellet. Lysis Buffer (added 7 mL to the 3.66g pellet).
Sonicate in 15mL cylindrical tubes, after completely dissolved pellet. Spin Down in centrifuge (20000g, 30 min, 4C).
Syringe filter after moving supernatant into a new tube.
Protein Purification: (7/2-3/14)
Nickel Column, wash out, then add sample, and pass Buffers (were prepared for us) through the column.
Take Concentrations of Elution 1 and 2: Elution 1: Elution 2:
Made PAGE gel for Protein Characterization:
Top Gel: 12% Resolving gel (2.15ml H2O, 1.25ml, 1M TrisHCl pH 8.9, 50uL 10% SDS, 31 uL 10% APS, 10uL TEMED)
Add 30% ethanol to make flat, and when gel is dry wash out ethanol with water.
Bottom gel: 5% Stacking gel (1.58 ml H2O, 625 uL 0.5M TrisHCl ph 6.8, 25uL 10% SDS, 25 uL 10% APS, 5uL TEMED)
Add comb and let dry.
We stored in 4C for 4 days.
pNIC-Bsa4 with pLIC-for primer:
pNIC-Bsa4 with pLIC-rev primer:
BLAST sample: 78% Query, 98% Identity Therefore sample is not close enough to pNIC, and may have contamination. Trash sample.
pGBR22 (First PCR Protocol) PCR Rerun:
Follow protocol from Week 3, but redo dilutions of DNA template.
Initial concentration of pGBR22: 255 ng/microL
Amount in each tube: (all in microliters)
TubeA: 5 microliters of MM, 1.2 of DNA dilution 1:1000, 17.8 DDW, 1 TaqPol
TubeB: 5 microliters of MM, 12 of DNA dilution 1:1000, 7 DDW, 1 TaqPol
TubeC: 5 microliters of MM, 12 of DNA dilution 1:100, 7 DDW, 1 TaqPol
TubeD: 5 microliters of MM, 0 of DNA dilution, 19 DDW, 1 TaqPol
Agarose Gel Electrophoresis Rerun:
Rerun and make gel, but use 0.84g instead of 0.7g of agarose
Only the ladder is visible in this gel, so something went wrong to make the samples not visible under the UV light.
A rerun is suggested of the My First PCR Protocol, once again. (Chris advised to use more blue dye than normal, so possibly trying that in Week 5).
Protein Expression- didn't get to work on because of absence (W-F)
Week 3
Transformation of competent cells for plasmid prep of pNic-Bsa4
Picked one colony from one of the 3 plates of DH5-alpha cells with pNic-Bsa4 plasmid present and placed in flask of 160 ml LB using pipette tip.
Add Kanamycin
Incubate to allow culture to grow overnight: 37°C 200-350rpm.
Result: Replication of DH5-alpha cells that contain the pNIC-Bsa4 plasmid. 20% sucrose solution
Materials:
130g sucrose in 653 mL nanopure water = 20% sucrose solution
Use bottle-cap filter: connect to hose to create the vacuum needed for the sucrose solution to filter through the filter.
Results: 20% sucrose solution made pGBR22 (First PCR Protocol)PCR-Polymerase Chain Reaction
Amplify Purple protein sequence in pPGR22 plasmid with forward and reverse primers (M13F and M13R)
Materials:
Master Mix (Buffer, dNTP, F Primer, R Primer)
DNA template (1:1000, 1:100)
Double Deionized Water
TaqPol 5U/microliter (1 of Taq, 5 of Nanopure water)
Amount in each tube: (all in microliters)
TubeA: 5 microliters of MM, 1.76 of DNA dilution 1:1000, 12.24 DDW, 1 TaqPol
TubeB: 5 microliters of MM, 17.6 of DNA dilution 1:1000, 1.4 DDW, 1 TaqPol
TubeC: 5 microliters of MM, 17.6 of DNA dilution 1:100, 1.4 DDW, 1 TaqPol
TubeD: 5 microliters of MM, 0 of DNA dilution, 19 DDW, 1 TaqPol
Prepare Lysis Buffer for Protein Expression:
Ratio: Tris 50nM, NaCl 300nM, Imidazole 10nM
Make 1000mL
So: 6.06g Tris, 17.5g NaCl, 0.68g Imidazole
First add 700mL of nanopure water, then add dry materials.
get pH level to 8.0 (initial= 10.32, used 12M HCl under fumehood to get to 7.99)
Add more Nanopure until 1000mL line.
Sterile filter with bottle cap filter.
Gel Electrophoresis
Materials: 0.7g agarose, 70 ml 1X TAE Buffer (980 ml DW, 20 ml 50X TAE)
Microwave to dissolve the agarose into solution (30 sec-2 min)
Add Ethidium Bromide (cancerous) 0.5 microliters
Pour into gel mold with wide side of well comb in gel, let solidify.
Prepare sample by adding 5 microliters of Blue Juice to each 25 microliter sample.
Put into gel bath with 1X TAE buffer, + is Red, so that should be on opposite side from the wells made by the comb.
This is because DNA is negatively charged and will travel from - to +.
Pipette 20 microliters of each sample (A-D) into wells, but put in first well 5 microliters of 100 bp ladder.
Let run at 100V until the blue line of DNA reaches 1inch from bottom.
Result of Run 1:
Observed: Ladder didn't show up neither did any of the samples. Lane 1 is ladder, Lanes 6-9 are my sample (A-D)
Reasons: Contamination and not enough DNA present
Midi Prep of pNIC-Bsa
Purpose: Extract pNic-Bsa4 that is in DH5-alpha cells.
Centrifuge after growing overnight. 6000g for 15 min, at 4C. Dispose of supernatant.
Resuspend pellet with Buffer P1 6ml (add in first tube, and swirl until dissolved pellet and transfer all of that into the next tube. (the first two tubes can then be trashed in biohazard)
Add Buffer P2 6ml. Invert 4-6 times.
Add Buffer P3 6ml. Invert 4-6 times.
Pour lysate into QIAfilter Cartridge. Leave for 10 minutes at room temperature.
Equilibrate HiSpeed Midi Tip by adding 4ml of QBT Buffer, let column empty.
Wash HiSpeed Midi Tip with 20mL of Buffer QCl Elute with 5mL Buffer QF.
Add 3.5mL isopropanol to eluted DNA and leave at room temp for 5
Remove plunger of 20mL syringe and to tip put the precipitator module (*Remove preciptator each time you pull back on plunger)
Filter isopropanol mixture through precipitator.
Reset plunger.
Add 2mL of 70% ethanol, and dry with kim wipe. Dry nozzle.
Put precipitator onto a 5ml syringe. Elute DNA into collection tube (1.5 mL). by adding 1mL Buffer TE.
Reset plunger, and pass through precipitator again by pouring into same 5mL syringe.
After this you would Nanodrop first to see if there was anything in the solution. Then send for DNA Sequencing.
DNA Sequencing/Nanodrop:
Average concentration with Nanodrop is 110.8 ng/microL.
DNA Sequencing Results:
results in Week 4
Order #: 104513 (ZA1 for, ZA2 rev)
Protein Expression (Sonification)
I was absent (class) for the morning this was done, but I took part in the Sonification portion of the protocol.
You place the probe inside the sample after cleaning the probe with ethanol.
Follow settings on how long to do each step.
This is meant to lyse the cells using high intensity sound waves.
Result: Sample was gone missing and could not be found. There fore the Protein Expression protocol must be repeated.
Week 1 & 2
Absorption of pGFP Nanodrop Spectrophotometry Figure 1: Absorbance of pGFP DNA template at 230 nm wavelength using Nanodrop spectrophotometry nucleic acid setting. Trial 1 resulted of pGFP absorbance of 15.502 and concentration of 1781.1 ng/uL using a 10 mm pathway. Wavelength (nm) shown on x-axis and absorbance shown on y-axis.
Figure 2: Absorbance of pGFP DNA template at 230 nm wavelength using Nanodrop spectrophotometry nucleic acid setting. Trial 2 resulted of pGFP absorbance of 12.508 and concentration of 1422.3 ng/uL using a 10 mm pathway. Wavelength (nm) shown on x-axis and absorbance shown on y-axis.
Transformation Efficiency Results Figure 3: Plate A contains 1 ng of pNIC-Bsa4 in competent DH5alpha cells grown in a kanamycin and SOC coated agar plate. A total of 112 colonies grew on this plate with a transformation efficiency of 112 colonies/ng.
Figure 4: Plate B contains 5 ng of pNIC-Bsa4 in competent DH5alpha cells grown in a kanamycin and SOC coated agar plate. A total of 79 colonies grew on this plate. With a transformation efficiency of 15.8 colonies/ng.
Figure 5: Plate B contains 25 ng of pNIC-Bsa4 in competent DH5alpha cells grown in a kanamycin and SOC coated agar plate. A total of 2592 colonies grew on this plate. With a transformation efficiency of 103.68 colonies/ng.
Figure 6: Plate D contains 0 ng of pNIC-Bsa4 in competent DH5alpha cells grown in a kanamycin and SOC coated agar plate. No colonies grew on this plate due to the absence of plasmid and as a result 0 transformation efficiency.
DNA Sequencing Results Figure 7. Sequencing FAIL. 269 out of ~865 Nucleotides were sequenced for the pGFP plasmid. This was sequenced using M13-F (Charina) and M13-R (shown above) primers. Forward Primer: 5’ TACTTCCAATCCATGCAGGCTAAGCGCG 3’ 28 bp GC Content 53.6% 0 mM Mg2+ Tm 64.6 oC 1.5 mM Mg2+ Tm 71.1 oC 2 mM Mg2+ Tm 71.6 oC 4 mM Mg2+ Tm 72.6 oC 6 mM Mg2+ Tm 73.1 o Reverse Primer: 5’ TATCCACCTTTACTGTTAAGACATGTGCATACCACCGT 3’ 38 bp GC Content 42.1% 0 mM Mg2+ Tm 64.1 oC 1.5 mM Mg2+ Tm 71.6 oC 2 mM Mg2+ Tm 72.1 oC 4 mM Mg2+ Tm 73.0 oC 6 mM Mg2+ ™ 73.4C
SUMMER 2015:
6/96/8
Organize Target page: TcSTPP
Tail Primers Ordered
5/4
Tail Primer Design
SUMMER/FALL 2014:
12042014- Where is weeks 11,12&13?1162014- Where is week 9,10?
Week 8
10/13/2014Finish Virtual Screening Refresher
Start Run 2: 1pm
10232014- Include more details and images
Week 7
10/10/2014Began work on Virtual Screening Refresher
Start of Run: 12:21pm
Will assess if clones match up with BpACR:
All clones came out with "no significant matches found" or a little matching as shown below:
Figure 1: Above is an example of the BLAST between the BpACR sequence and the DNA sequencing results that I received.
The sequences that matched were just part of the pNic backbone.
A BLAST with any known sequences shows below:
Figure 2: Above is the result of blasting the last (3F) sequence from DNA sequencing with any known sequences.
The first match is with the pNic vector.
Week 6
--No lab work--Week 5
9/22/2014DNA Sequencing results arrived: Order ID:
Label:
1F- Plate C Colony 1
1R- Plate C Colony 1
2F- Plate D Colony 1
2R- Plate D Colony 1
3F- Plate D Colony 2
3R- Plate D Colony 2
Week 4
9/19/2014Miniprep of overnight cultures
Resulted in good concentrations in each of the 3 tubes.
Nanodrops:
Figure 1: Tube 1 culture from the Colony on Plate C came out with a concentration of about 49.5 ng/ul at 230 nm wavelngth and 10 mm Absorbance pathway.
Figure 2: Tube 2 culture from the first colony on Plate D had a concentration about 43.5 ng/ul at 230 nm wavelength and 10 mm Absorbance pathway.
Figure 3: Tube 3 culture from second colony in Plate D had a concentration of about 56 ng/ul at 230 nm wavelength and 10 mm Absorbance pathway.
9/18/2014
Master Plate & overnight culture
Tube 1: Colony 1 from Plate C
Tube 2: Colony 1 from Plate D
Tube 3: Colony 2 from Plate D
Set overnight culture in LB+ Kan tubes in incubator (max ~16 hours), made Master Plate (LB, Kan, Suc) with all 3 of those colonies (7pm)
Checked Plates and there were colonies!
Figure 1: Plates A and B didn't have any growth. The dots are sucrose crystalized due to the incubation.
Figure 2: Plates C and D both had growth. Plate C had 1 colony, Plate D had 2. Again, there are many sucrose crystals.
9/16/2014
Annealing and Transformation
A- 2:4
B- 5:5
C- 15:10
D- 10:12.5
Cohesion End Generation
Same protocol as usual, make sure sterile!
-instead of using 30 minutes at RT, I changed to 50 minutes.
-heat shock time interval remained the same
9/15/2014
pNic Accepting Vector Prep
two samples made as usual.
Concentration: 110.5 ng/ul
Figure 1: Nanodrop results of accepting vector prep. Concentration was 110.5 ng/ul at 230nm wavelength on a 10 mm pathway.
Week 3
9/10/2014
Repeat PCR squared and PCR Cleanup
Made twice as much Tube A and Tube B
Nanodrop:
Figure 1: Nanodrop of Tube A of PCR squared sample. Concentration was about 75 ng/ul at 230 nm wavelength on 10 mm absorbance pathway.
Figure 2: Nanodrop of Tube B of PCR squared sample. Concentration was about 100 ng/ul at 230 nm wavelength on 10 mm absorbance pathway.
9/9/2014
Repeat pNic AV Prep (couldn't use because didn't have any PCR squared sample)
9/8/2014
Make LB agar plates- 23 plates made
Week 2
9/7/2014
Plate Check:
Figure 1: Plates A-D all had heavy contamination.
Unsure as to why, but potentially the Kanamycin used on the plates had gone bad.
9/5/2014
Annealing and Transformation
Ratios:
A- 2:4
B- 4:4
C- 3:5
D- 10:7
Cohesion End Generation
PCR Insert (make 3 tubes) and Accepting Vector
9/3/2014
pNice Accepting Vector
Same protocol
Nanodrop:
Figure 1: Nanodrop of AV Prep of pNic-Bsa4. Concentration is about 85 ng/ul at 230 nm wavelngth on 10 mm Absorbance.
Samples were good concentration so they should be good to use with cohesion end generation.
Agarose Gel:
Figure 1: Agarose gel of cut pNic. The second ladder is 1 kb ladder and the sample to the right of it is my cut pNic.
The SacB gene that was removed is slightly visible in this agarose gel. The RE digest was successful.
Week 1
8/29/2014PCR squared
Concentration:
Figure1: Nanodrop of PCR square. Concentration is about 42 ng/ul at 230 nm wavelength on 10 mm Absorbance.
Agarose gel of Secondary PCR
Figure 1: Agarose gel of secondary PCR. Lane 1 is the 1000 bp ladder, Lane 2 is the 1 kb ladder,
and Lane 3 is my secondary sample.
My secondary sample is under the 1 kb marker and above the 500 bp marker, and is approximately 750 bp. This is really close to BpACR's 747 bp length.
PCR Squared:
Same protocol as before but made twice as much. Start @ 2:55pm to 3:45
Secondary PCR:
Same protocol
8/28/2014
Left PCR squared sample in Lamborghini and someone turned it off overnight, so sample was lost.
PCR squared
same protocol as usual
Secondary PCR
Same protocol as usual
-----------------------------END OF SUMMER 2014--------------------------------
Week 9
7/30/2014Resulting Plates from Run 4 of Cohesion End Generation and Annealing
Figure1: Plate A (2:4)
Figure 2: Plate B (4:4)
Figure 3: Plate C (3:5)
The plates didn't have growth when I checked at 1pm, but I checked again at 4:30pm and plate B had a little bit of growth.
I won't be able to come into lab for the remainder of summer, so since I couldn't store these plates until Fall, I had to throw away the plates :'( (Sad day)
7/29/2014
Cohesion End generation and Plating
Follow same protocol but different ratios this time
Other procedures:
Tried making plates but Autoclaving the LB caused it to overflow twice
Great images shown below! :D
Round 1: Autoclave v. VDS => Autoclave
Round 2: Autoclave v. VDS => Autoclave
Action shots!
Boss Level: Cidia/Zain v. solidified LB ==> CIDIA/ZAIN
Covering up the losses :(
Lesson Learned: Use Liquid 6 now!
Next time VDS will win!
7/28/2014
Rerun of pNIC-Bsa4 Accepting Vector Prep
Redo same protocol, but made sure to use Buffer 4! I had potentially been using Buffer 2 for this step.
Figure 1: Nanodrop of pNIC AV prep with BsaI. 10 mm pathway, 230 nm wavelength. 88.2 ng/ul
Figure 2: Nanodrop of pNIC AV Prep with BsaI. 10 mm pathway, 230 nm wavelength. 89.2 ng/ul
The concentration was good at 88.7 ng/ul so tomorrow I will continue the Cohesion end generation.
Week 8
7/24/2014Rerun of DNA sequencing results:
The forward primer results had many Ns, so I used the reverse, and looking at the graph matched up the Ns with the correct base pair.
They all matched, so this is a successful pNIC-Bsa4 and can be used as the vector.
Rerun of Cohesion End Generation and Annealing/Tranformation Plates
Repeat the same procedure as last time, but this time allow plates to grow without parafilm or seran wrap.
Same ratios were used.
Figure 1: Plates A-F of run 3 DH5alpha with pNIC-Bsa4 and BpACR.
There was still no growth. Time to rerun...
7/23/2014
DNA Sequencing results
There are many Ns within the two sequences, but the Core emailed saying they will dilute and rerun.
Results of second run of cloning plates
Figure 1: I didn't get a chance to take pictures of individual plates.
There was no growth yet again.
Rerun of PCR squared to make more of BpACR insert
Figure 1: Nanodrop (2 trials) of BpACR insert after PCR squared was ran. 10 mm pathway. 230 nm wavelength. Concentration came to be 112 ng/ul.
Rerun of pNIC-Bsa4 Prep as Accepting Vector
Same protocol and steps as before.
Figure1: 12 images of the 6 tubes of pNIC Accepting vector that was prepared with BsaI. 10 mm Pathway. 230 nm wavelength. The concentration came out to be 25.2 ng/ul.
The concentrations all came out low due to using 50 uL of elution solution
7/22/2014
Redo Cohesion End Generation
and plating
Same protocol and but I made twice the amount of PCR Insert to allow for the 6 plates that I planned to make this round.
The ratios I used were as follows:
Figure 1: I didn't get a chance to take pictures of individual plates, but there was no growth.
I also ran a gel on the cut pNIC-Bsa4 with BsaI, to ensure that the accepting vector was cut correctly.
Figure 1: Agarose gel of pNIC-Bsa4 cut with BsaI. Lane 1 is the 1kb ladder. Lane 2 is the sample of cut pNIC.
The plasmid was cut at the correct length it seemed.
Other Procedures:
Made plates: first forgot to put in Agar, so had to remake plates. Made ~60 plates total
7/21/2014
DNA Sequencing of pNIC
Sent samples to be sequenced
Rerun of Vector prep (Run 4)
I reran the Vector prep protocol, the concentration came out good this time.
Figure 1: Nanodrop of pNIC Accepting vector prep at 10 mm pathway, 230 nm wavelength.
Concentration is 69.7 ng/ul (n=2).
Figure 2: Nanodrop of pNIC Accepting vector prep at 10 mm pathway, 230 nm wavelength.
Concentration is 71.2 ng/ul (n=2).
my partner is the best aka Nikki shes so cool can i be her i wish hahaah
Zain - ok good work. Go into another round of cloning and see if you can get colonies. Go ahead and think about getting a 3rd round going shortly after you have the second one started. - Dr. B 072114
Week 7
Good work. Is this sequential? Try to put dates on specific protocol and results. Keep the newest stuff on the top. -Grace (7/15/14)7/18/2014
MidiPrep of pNIC plasmid
the culture of bacteria grown overnight was midiprepped
Post midiprep, the concentration was taken:
Figure 1: Nanodrop of pNIC midiprepped sample (n=2). Concentration is 77.7 ng/ul at 230 mm Absorbance at 10 mm pathway.
Figure 2: Nanodrop of pNIC midiprepped sample (n=2). Concentration is 79.8 ng/ul at 230 mm Absorbance at 10 mm pathway.
I also need to send to DNA sequencing.
pNIC accepting vector re run Concentrations
concentration came out too low so I will redo next week.
Figure 1: Nanodrop of pNIC accepting vector prep at 10 mm Absorbance. Concentration of 5.3 ng/ul at 230 nm wavelength. (n=2)
Figure 2: Nanodrop of pNIC accepting vector prep at 10 mm Absorbance. Concentration of 6.8 ng/ul at 230 nm wavelength. (n=2)
The concentration is very low, so I will rerun this step next week.
7/17/2014
Plates didn't have growth at 1pm, 3pm, or 6:30pm. Check again tomorrow, if no growth, remake pNIC-Bsa4 accepting vector and repeat.
Figure 1: Plates A-D with DH5-alpha cells containing pNIC-Bsa4 and BpACR insert on LB Amp plates.
There was no growth on these plates, I will rerun the protocol.
The plates had no growth because they were ampicillin plates, so the bacteria potentially died if there was going to be any growth.
ugh :( stupid mistakes!
Grow pNIC-Bsa4 plasmid in DH5-alpha cells in overnight flask culture
Prepare sucrose 20% solution for LB agar + Kan plates.
Added 40g of sucrose to 200mL water. Bottle Top filtered and added 167 mL of that to 500mL LB agar solution.
Rerun of Accepting vector prep
same as before and run PCR Cleanup, nanodrops are on next day.
Cohesive End Generation on PCR Insert and Accepting Vector: (7/16/18)
Mixed components together: fragment/vector, NEBuffer 2, dCTP/dGTP, DTT, BSA, and T4 DNA Pol.
Incubate first at room temperature for 30 minutes, and then for 20 minutes heat shock at 75C.
Here someone may have accidentally bumped up my 75C heat block to 110C, and this denatured my sample.
So i had to redo it, then moved onto the Annealing and Transformation.
Annealing and Transformation:
For plate A i did 2 uL of Accepting vector to 4 uL of PCR Insert
Plate B- 3 uL of Accepting vector to 4 uL of PCR Insert
Plate C- 2 uL of Accepting vector to 5 uL of PCR Insert
Plate D- 3 uL of Accepting vector to 3 uL of PCR Insert
Incubate at room temp for 10 minutes, then place on ice and add 25 uL of DH5-alpha cells. Incubate for 30 minutes on ice, then heat shock at 42C.
Place on ice and add pre warmed SOC media.
Incubate each of these samples in the 37C shaker for 1 hour.
After the 1 hour, spread these onto LB-agar plates with Kanamycin.
Parafilm the 4 plates after labeling. Incubate for 1 day in 37C (start time: 9pm 7/16/14)
Began Transfer of Gene of interest into pNIC-Bsa4 (7/14/14)
Add the plasmid, buffer, BSA, Restriction Enzyme BsaI-HF into 2 tubes.
Incubate for 3 hours after making the 2 tubes of sample to prepare pNIC-Bsa4 for BpACR.
Figure1: Water bath set to 37C, to incubate the samples for 3 hours.
PCR cleanup this sample to extract the pNIC-Bsa4 cut plasmid.
Nanodrop this sample.
I then ran a gel on the prepared pNIC Bsa4 vector, to ensure that the BsaI restriction enzyme worked and resulted in 2 pieces.
I had to repeat the pNIC-Bsa4 preparation because my concentration of 26 ng/uL was low.
7/15/18
Here are the Nanodrop results from that:
(Place Nanodrops of sample here)
I then ran a gel again on the prepared pNIC Bsa4 vector, to ensure that the BsaI restriction enzyme worked and resulted in 2 pieces.
Week 6
Trip to TACC site at Pickle Campus:
(Insert Pictures here)
Oligomix and PCR to obtain full Sequence:
Look up where my oligos are located:
My samples of BpACR were located in B12, C1-12, D1-5 (18 wells total).
100-18= 82 uL of water into a 1.7ml PCR tube.
Pipette up and down in each well then add 1 uL from each well into the PCR Oligomix tube, to make total of 100 uL.
Pipette up and down to mix Oligomix.
Run Primary PCR:
Sample: 10uL of 5X Rxn Buffer, 5 uL of diluted 2mM dNTPs, 1 uL of Oligomix, 0.5 uL of diluted Q5 hotstart Polymerase (1U/ul), 33.5 uL of dH2O
PCR Settings:
2 min: 98C
20 sec: 98C (Denaturation) 20 cycles
10 sec: 58C (Annealing) 20 cycles
20 sec: 72C (Elongation) 20 cycles (20-30 sec/kb)
2 min: 72C (Elongation)
Infinity: 4C (Storage)
Run Agarose Gel:
Mix 10 ul of this sample and 2 ul of blue juice and put into wells.
Results:
Secondary PCR: (7/9/2014)
Sample: 10uL of 5X Rxn Buffer, 5 uL of diluted 2mM dNTPs, 1 uL of Oligomix, 1uL of 20 uM F primer, 1uL of 20 uM R primer, 0.5 uL of diluted Q5 hotstart Polymerase (1U/ul), 31.5 uL of dH2O
PCR Settings:
2 min: 98C
20 sec: 98C (Denaturation) 30 cycles
10 sec: 58C (Annealing) 30 cycles
25 sec: 72C (Elongation) 30 cycles (20-30 sec/kb)
2 min: 72C (Elongation)
Infinity: 4C (Storage)
Stored in my Box @ -20C, run Gel tomorrow
Gel Results:
Figure1: Lane 2 is the 1kb ladder, Lane3 is my primary PCR sample, Lane4 is my secondary PCR sample. Lane 6-7 are Brianna's samples.
Secondary PCR results from the gel show that the primers forward and reverse worked in connecting the oligos into a single strand pretty efficiently.
PCR Cleanup:
I ran PCR cleanup, following instructions to adding the solutions. But instead of using the table top centrifuge, I used the bubble centrifuge, so the sample was centrifuged at 6000g instead of the 12000-16000g requested. :(
I then added an extra 20 uL of Elution buffer and ran the sample in the filter/collection tube unit for 2 minutes at 16000g.
Figure1: I resulted in getting a sample that was 70 ng/uL from Nanodrop using a 10 mm Absorbance pathway.
Figure 2: 701 ng/uL from Nanodrop using a 10 mm Absorbance pathway at 230 nm wavelength.
The overall concentration is 71.55 ng/uL.
This means that even though I didn't use the correct centrifuge, I still have DNA in my sample. I will send for DNA sequencing on Monday. The potentially redo PCR squared if the sequence is incorrect.
Run PAGE Gel from Characterization:
Fill with 1X TGS Buffer, over fill space between gel and buffer dam and fill until 2 gels line.
Remove comb and Clear wells with syringe.
Prepare samples 3-6 (since we didn't have 0-2). Add 4uL of blue juice to 20uL of sampel to reduce 6X-->1X.
Then heat block at 95C for 5min. Centrifuge for 2 min at 5000 rpm.
Fill wells with Colorstain protein ladder and samples 3-6 and run for 45 minutes, on 200V.
Destaining Gel:
Wash in water 3 times, and wash overnight to remove staining.
Destaining in progress
Remove from water and take a picture before drying.
Put on filter paper and cover with cellophane as seen below.
Resulting Dried Gel:
PAGE Gel: first lane is the Colorstain Ladder, then Samples 3-6. Since Sample 6 shows a darker sample. It is upside down when we placed it on the filter paper before drying, so the results are Right to Left instead of Left to Right. The top gel fell off when we were transferring the gel onto the filter paper.
Next time run PAGE gel for longer than 20 minutes, this way the lines are more spaced out.
This means our protein was amplified and we should FPLC the remaining sample to extract the FtHap protein
Restriction Enzyme Digest:
Goal: digest pGBR22 plasmid with restriction enzymes and visualize fragments on gel.
EcoRI and PvuII both use NEB Buffer 2.1, or 2.
1: EcoRI
2: PvuII
3: EcoRI and PvuII
Digestion:
1.5 ug plasmid (304.2 ng/ul --> 4.93 ul)
2.5 ul 10X Enzyme Buffer
X uL water to 24 uL total
1 uL of Restriction enzyme (or 0.5 of each)
Total: 25 uL.
Pipette up/down to mix. Spin down, wrap with Parafilm and incubate for 2 hours in 37C.
Kill enzyme at 85C for 20 minutes, then spin down.
Prepare the samples for Gel electrophoresis, but adding 3 uL of plasmid, 2 uL of blue juice, and 7 uL of buffer.
Run gel:
BLAST pNIC sample from MidiPrep. Sequence turned out to be not as close to pNIC sequence as desired, so trash sample of pNIC.
Week 5
pGBR22 Rerun:
Agarose gel for pNIC (Nikki) and pGBR22 (Zain) PCR gel. Lane 1 has the 1kb DNA ladder, Lane 2-5 are pNic, Lanes 6-9 are pGBR22. pGBR22 should show an increasing light gradient upon increase of pGBR22 template, but there may have been a mixup of tubes causing the altered view.
pLIC PCR (Second PCR Protocol):
Made 3 dilutions of pNIC: 1:10 (7.625ng) , 1:100 (0.7625ng), and 1:1000 (.07625ng) (add 1 uL per tube)
Master mix: 12.5 Buffer, 2.5 dNTP, 5 of F and R primers, 90 DDW; add 23 uL in each tube
add 18 uL of water into each tube, but 19 uL in control tube.
PCR Settings:
3 min: 94C
30 sec: 94C (Denaturation) 30 cycles
30 sec: 53C (Annealing) 30 cycles
1 min: 72C (Elongation) 30 cycles
5 min: 72C (Elongation)
Infinity: 4C (Storage)
Gel:
Make usual Agarose gel (.83g agarose)
pLIC gel: shows increasing gradient of plasmid as expected, with last lane having no sample so it is blank.
DNA sequence for acetoacetyl-CoA reductase - Burkholderia pseudomallei from DNA Works Ouput.
ATGCAGGCTAAGCGCGTTGCGTTTGTTACGGGTGGCATGGGTGGTCTGGGTGCTGCGATCTCTCGTCGTCTGCACGACGCCG
GTATGGCTGTTGCAGTTTCTCACTCTGAACGTAACGATCATGTTTCTACCTGGCTGATGCACGAACGTGATGCGGGTCGTGACT
TCAAAGCTTACGCTGTTGACGTCGCGGATTTCGAATCTTGCGAACGTTGCGCGGAAAAAGTTCTGGCGGACTTCGGTAAAGTG
GATGTTCTGATCAACAACGCAGGCATTACCCGTGACGCGACCTTTATGAAAATGACCAAAGGTGACTGGGACGCGGTTATGCG
TACCGACCTGGACGCGATGTTCAACGTTACCAAACAATTCATCGCGGGTATGGTTGAACGTCGTTTCGGTCGTATTGTTAATATCG
GTTCTGTTAATGGTTCTCGTGGTGCGTTCGGTCAAGCGAACTACGCGTCTGCGAAAGCGGGCATCCACGGTTTCACCAAAACCC
TGGCGCTGGAAACCGCGAAACGTGGTATCACCGTTAACACCGTTTCTCCGGGTTACCTCGCTACTGCCATGGTCGAAGCGGTTC
CGCAGGACGTTCTGGAAGCGAAAATCCTGCCGCAGATCCCGGTTGGTCGCCTGGGTCGTCCGGATGAAGTTGCGGCGCTGAT
CGCGTTCCTGTGCTCTGACGACGCGGGCTTTGTAACCGGTGCGGACCTGGCGATCAACGGTGGTATGCACATGTCTTAA
DNA sequence with Leading and Lagging strands of primer:
Primer Selection:
TACTTCCAATCCATGCAGGCTAAGCGCGTTGCGTTTGTTACGGGTGGCATGGGTGGTCTGGGTGCTGCGATCTCTCGTCGTCTG
CACGACGCCGGTATGGCTGTTGCAGTTTCTCACTCTGAACGTAACGATCATGTTTCTACCTGGCTGATGCACGAACGTGATGCG
GGTCGTGACTTCAAAGCTTACGCTGTTGACGTCGCGGATTTCGAATCTTGCGAACGTTGCGCGGAAAAAGTTCTGGCGGACTTC
GGTAAAGTGGATGTTCTGATCAACAACGCAGGCATTACCCGTGACGCGACCTTTATGAAAATGACCAAAGGTGACTGGGACGCG
GTTATGCGTACCGACCTGGACGCGATGTTCAACGTTACCAAACAATTCATCGCGGGTATGGTTGAACGTCGTTTCGGTCGTATTG
TTAATATCGGTTCTGTTAATGGTTCTCGTGGTGCGTTCGGTCAAGCGAACTACGCGTCTGCGAAAGCGGGCATCCACGGTTTCAC
CAAAACCCTGGCGCTGGAAACCGCGAAACGTGGTATCACCGTTAACACCGTTTCTCCGGGTTACCTCGCTACTGCCATGGTCGAA
GCGGTTCCGCAGGACGTTCTGGAAGCGAAAATCCTGCCGCAGATCCCGGTTGGTCGCCTGGGTCGTCCGGATGAAGTTGCGGCG
CTGATCGCGTTCCTGTGCTCTGACGACGCGGGCTTTGTAACCGGTGCGGACCTGGCGATCAACGGTGGTATGCACATGTCTTAA
Reverse Primer: (reverse compliment)
TATCCACCTTTACTGTTAAGACATGTGCATACCACCGTTGATCGCCAGGTCCGCACCGGTTACAAAGCCCGCGTCGTCAGAGCACA
GGAACGCGATCAGCGCCGCAACTTCATCCGGACGACCCAGGCGACCAACCGGGATCTGCGGCAGGATTTTCGCTTCCAGAACGTC
CTGCGGAACCGCTTCGACCATGGCAGTAGCGAGGTAACCCGGAGAAACGGTGTTAACGGTGATACCACGTTTCGCGGTTTCCAGC
GCCAGGGTTTTGGTGAAACCGTGGATGCCCGCTTTCGCAGACGCGTAGTTCGCTTGACCGAACGCACCACGAGAACCATTAACAG
AACCGATATTAACAATACGACCGAAACGACGTTCAACCATACCCGCGATGAATTGTTTGGTAACGTTGAACATCGCGTCCAGGTCG
GTACGCATAACCGCGTCCCAGTCACCTTTGGTCATTTTCATAAAGGTCGCGTCACGGGTAATGCCTGCGTTGTTGATCAGAACATCC
ACTTTACCGAAGTCCGCCAGAACTTTTTCCGCGCAACGTTCGCAAGATTCGAAATCCGCGACGTCAACAGCGTAAGCTTTGAAGTCA
CGACCCGCATCACGTTCGTGCATCAGCCAGGTAGAAACATGATCGTTACGTTCAGAGTGAGAAACTGCAACAGCCATACCGGCGTC
GTGCAGACGACGAGAGATCGCAGCACCCAGACCACCCATGCCACCCGTAACAAACGCAACGCGCTTAGCCTGCATGGATTGGAAGTA
Primers on wishlist:
Protein Expression:
FtHap in BL21 cells.
Small Culture 6/30/14
Large Culture: added total of 25 mL when OD600=0.104 (7/1/14)
After adding Kan, and incubating (37C), check every 30 minutes until OD600=0.5. But went over to 0.684, because we were in FPLC room observing.
So more sample.
added 259.5 uL of IPTG to induce expression. Incubate for 4 hours.
Centrifuge (20 min, 6000g, 4C, in 500ml cyndrical bottles) and collect pellet. Lysis Buffer (added 7 mL to the 3.66g pellet).
Sonicate in 15mL cylindrical tubes, after completely dissolved pellet. Spin Down in centrifuge (20000g, 30 min, 4C).
Syringe filter after moving supernatant into a new tube.
Protein Purification: (7/2-3/14)
Nickel Column, wash out, then add sample, and pass Buffers (were prepared for us) through the column.
Take Concentrations of Elution 1 and 2:
Elution 1:
Elution 2:
Made PAGE gel for Protein Characterization:
Top Gel: 12% Resolving gel (2.15ml H2O, 1.25ml, 1M TrisHCl pH 8.9, 50uL 10% SDS, 31 uL 10% APS, 10uL TEMED)
Add 30% ethanol to make flat, and when gel is dry wash out ethanol with water.
Bottom gel: 5% Stacking gel (1.58 ml H2O, 625 uL 0.5M TrisHCl ph 6.8, 25uL 10% SDS, 25 uL 10% APS, 5uL TEMED)
Add comb and let dry.
We stored in 4C for 4 days.
Week 4
Analyze DNA Sequence:
Google Doc: https://drive.google.com/file/d/0B4O2KqKh2q_-QnhUYkdldWxxM1E/edit?usp=sharing
DNA Sequencing of MidiPrep Results:
pNIC-Bsa4 with pLIC-for primer:
pNIC-Bsa4 with pLIC-rev primer:
BLAST sample: 78% Query, 98% Identity
Therefore sample is not close enough to pNIC, and may have contamination. Trash sample.
pGBR22 (First PCR Protocol) PCR Rerun:
Follow protocol from Week 3, but redo dilutions of DNA template.
Initial concentration of pGBR22: 255 ng/microL
Amount in each tube: (all in microliters)
TubeA: 5 microliters of MM, 1.2 of DNA dilution 1:1000, 17.8 DDW, 1 TaqPol
TubeB: 5 microliters of MM, 12 of DNA dilution 1:1000, 7 DDW, 1 TaqPol
TubeC: 5 microliters of MM, 12 of DNA dilution 1:100, 7 DDW, 1 TaqPol
TubeD: 5 microliters of MM, 0 of DNA dilution, 19 DDW, 1 TaqPol
Agarose Gel Electrophoresis Rerun:
Rerun and make gel, but use 0.84g instead of 0.7g of agarose
Only the ladder is visible in this gel, so something went wrong to make the samples not visible under the UV light.
A rerun is suggested of the My First PCR Protocol, once again. (Chris advised to use more blue dye than normal, so possibly trying that in Week 5).
Protein Expression- didn't get to work on because of absence (W-F)
Week 3
Transformation of competent cells for plasmid prep of pNic-Bsa4
Picked one colony from one of the 3 plates of DH5-alpha cells with pNic-Bsa4 plasmid present and placed in flask of 160 ml LB using pipette tip.
Add Kanamycin
Incubate to allow culture to grow overnight: 37°C 200-350rpm.
Result: Replication of DH5-alpha cells that contain the pNIC-Bsa4 plasmid.
20% sucrose solution
Materials:
130g sucrose in 653 mL nanopure water = 20% sucrose solution
Use bottle-cap filter: connect to hose to create the vacuum needed for the sucrose solution to filter through the filter.
Results: 20% sucrose solution made
pGBR22 (First PCR Protocol) PCR-Polymerase Chain Reaction
Amplify Purple protein sequence in pPGR22 plasmid with forward and reverse primers (M13F and M13R)
Materials:
Master Mix (Buffer, dNTP, F Primer, R Primer)
DNA template (1:1000, 1:100)
Double Deionized Water
TaqPol 5U/microliter (1 of Taq, 5 of Nanopure water)
Amount in each tube: (all in microliters)
TubeA: 5 microliters of MM, 1.76 of DNA dilution 1:1000, 12.24 DDW, 1 TaqPol
TubeB: 5 microliters of MM, 17.6 of DNA dilution 1:1000, 1.4 DDW, 1 TaqPol
TubeC: 5 microliters of MM, 17.6 of DNA dilution 1:100, 1.4 DDW, 1 TaqPol
TubeD: 5 microliters of MM, 0 of DNA dilution, 19 DDW, 1 TaqPol
Reserve a PCR machine
Settings:
3 min: 94C
30 sec: 94C (Denaturation) 30 cycles
30 sec: 45C (Annealing) 30 cycles
1 min: 72C (Elongation) 30 cycles
5 min: 72C (Elongation)
Infinity: 4C (Storage)
Add TaqPol right before placing on PCR machine.
Let PCR Run.
Prepare Lysis Buffer for Protein Expression:
Ratio: Tris 50nM, NaCl 300nM, Imidazole 10nM
Make 1000mL
So: 6.06g Tris, 17.5g NaCl, 0.68g Imidazole
First add 700mL of nanopure water, then add dry materials.
get pH level to 8.0 (initial= 10.32, used 12M HCl under fumehood to get to 7.99)
Add more Nanopure until 1000mL line.
Sterile filter with bottle cap filter.
Gel Electrophoresis
Materials: 0.7g agarose, 70 ml 1X TAE Buffer (980 ml DW, 20 ml 50X TAE)
Microwave to dissolve the agarose into solution (30 sec-2 min)
Add Ethidium Bromide (cancerous) 0.5 microliters
Pour into gel mold with wide side of well comb in gel, let solidify.
Prepare sample by adding 5 microliters of Blue Juice to each 25 microliter sample.
Put into gel bath with 1X TAE buffer, + is Red, so that should be on opposite side from the wells made by the comb.
This is because DNA is negatively charged and will travel from - to +.
Pipette 20 microliters of each sample (A-D) into wells, but put in first well 5 microliters of 100 bp ladder.
Let run at 100V until the blue line of DNA reaches 1inch from bottom.
Result of Run 1:
Observed: Ladder didn't show up neither did any of the samples. Lane 1 is ladder, Lanes 6-9 are my sample (A-D)
Reasons: Contamination and not enough DNA present
Midi Prep of pNIC-Bsa
Purpose: Extract pNic-Bsa4 that is in DH5-alpha cells.
Centrifuge after growing overnight. 6000g for 15 min, at 4C. Dispose of supernatant.
Resuspend pellet with Buffer P1 6ml (add in first tube, and swirl until dissolved pellet and transfer all of that into the next tube. (the first two tubes can then be trashed in biohazard)
Add Buffer P2 6ml. Invert 4-6 times.
Add Buffer P3 6ml. Invert 4-6 times.
Pour lysate into QIAfilter Cartridge. Leave for 10 minutes at room temperature.
Equilibrate HiSpeed Midi Tip by adding 4ml of QBT Buffer, let column empty.
Wash HiSpeed Midi Tip with 20mL of Buffer QCl Elute with 5mL Buffer QF.
Add 3.5mL isopropanol to eluted DNA and leave at room temp for 5
Remove plunger of 20mL syringe and to tip put the precipitator module (*Remove preciptator each time you pull back on plunger)
Filter isopropanol mixture through precipitator.
Reset plunger.
Add 2mL of 70% ethanol, and dry with kim wipe. Dry nozzle.
Put precipitator onto a 5ml syringe. Elute DNA into collection tube (1.5 mL). by adding 1mL Buffer TE.
Reset plunger, and pass through precipitator again by pouring into same 5mL syringe.
After this you would Nanodrop first to see if there was anything in the solution. Then send for DNA Sequencing.
DNA Sequencing/Nanodrop:
Average concentration with Nanodrop is 110.8 ng/microL.
DNA Sequencing Results:
results in Week 4
Order #: 104513 (ZA1 for, ZA2 rev)
Protein Expression (Sonification)
I was absent (class) for the morning this was done, but I took part in the Sonification portion of the protocol.
You place the probe inside the sample after cleaning the probe with ethanol.
Follow settings on how long to do each step.
This is meant to lyse the cells using high intensity sound waves.
Result: Sample was gone missing and could not be found. There fore the Protein Expression protocol must be repeated.
Week 1 & 2
Absorption of pGFP Nanodrop Spectrophotometry
Figure 1: Absorbance of pGFP DNA template at 230 nm wavelength using Nanodrop spectrophotometry nucleic acid setting. Trial 1 resulted of pGFP absorbance of 15.502 and concentration of 1781.1 ng/uL using a 10 mm pathway. Wavelength (nm) shown on x-axis and absorbance shown on y-axis.
Figure 2: Absorbance of pGFP DNA template at 230 nm wavelength using Nanodrop spectrophotometry nucleic acid setting. Trial 2 resulted of pGFP absorbance of 12.508 and concentration of 1422.3 ng/uL using a 10 mm pathway. Wavelength (nm) shown on x-axis and absorbance shown on y-axis.
Transformation Efficiency Results
Figure 3: Plate A contains 1 ng of pNIC-Bsa4 in competent DH5alpha cells grown in a kanamycin and SOC coated agar plate. A total of 112 colonies grew on this plate with a transformation efficiency of 112 colonies/ng.
Figure 4: Plate B contains 5 ng of pNIC-Bsa4 in competent DH5alpha cells grown in a kanamycin and SOC coated agar plate. A total of 79 colonies grew on this plate. With a transformation efficiency of 15.8 colonies/ng.
Figure 5: Plate B contains 25 ng of pNIC-Bsa4 in competent DH5alpha cells grown in a kanamycin and SOC coated agar plate. A total of 2592 colonies grew on this plate. With a transformation efficiency of 103.68 colonies/ng.
Figure 6: Plate D contains 0 ng of pNIC-Bsa4 in competent DH5alpha cells grown in a kanamycin and SOC coated agar plate. No colonies grew on this plate due to the absence of plasmid and as a result 0 transformation efficiency.
DNA Sequencing Results
Figure 7. Sequencing FAIL. 269 out of ~865 Nucleotides were sequenced for the pGFP plasmid. This was sequenced using M13-F (Charina) and M13-R (shown above) primers.
Forward Primer:
5’ TACTTCCAATCCATGCAGGCTAAGCGCG 3’ 28 bp
GC Content 53.6%
0 mM Mg2+ Tm 64.6 oC 1.5 mM Mg2+ Tm 71.1 oC 2 mM Mg2+ Tm 71.6 oC
4 mM Mg2+ Tm 72.6 oC 6 mM Mg2+ Tm 73.1 o
Reverse Primer:
5’ TATCCACCTTTACTGTTAAGACATGTGCATACCACCGT 3’ 38 bp
GC Content 42.1%
0 mM Mg2+ Tm 64.1 oC 1.5 mM Mg2+ Tm 71.6 oC 2 mM Mg2+ Tm 72.1 oC
4 mM Mg2+ Tm 73.0 oC 6 mM Mg2+ ™ 73.4C